Nimble Cloning is applicable for the cloning of single or multiple fragments, as well as multi-site cloning. Due also to its simplicity and versatility, the cloning method has great potential for the modular assembly of DNA constructs. Molecular cloning, which is one of the most fundamental procedures available for modern molecular biology research, has been critical for driving biotechnological advances.
One of the main objectives in the post-genomics era is to functionally map gene expression data. Thus, developing methods for the rapid and efficient construction of various vectors for transgenic research is more critical now than ever before. To the best of our knowledge, of the many molecular cloning protocols that have been developed, the following are the main techniques currently used for routine cloning: restriction digestion- and ligation-based cloning Cohen et al.
Each of these methods have specific limitations Liang et al. Traditionally, type II restriction endonucleases and DNA ligases have been used to construct recombinant plasmids, and these enzymes are still extensively used for diverse molecular biology applications.
However, this method is laborious and time-consuming and is often limited by the relatively few available restriction enzyme sites, especially during the assembly of complex plasmids from multiple elements Lampropoulos et al. Gateway cloning is a very popular site-specific recombination system that exploits the lambda phage integration and excision mechanism Hartley et al.
Although Gateway cloning has been widely used in many experimental systems, the following are the four main disadvantages with this method: i the associated two-step BP and LR recombination reactions cloning process is labor-intensive and time-consuming; ii the recombination site leaves a bp unwanted junk sequence scar ; iii the assembly of multiple fragments is relatively inefficient; and iv the commercial enzyme mixes available for this method are expensive, especially for laboratories in developing countries.
As an alternative, Gibson assembly is a quick and easy method that enables the linking of multiple overlapping DNA fragments in a single isothermal reaction Gibson et al.
The recombination is based on the homologous ends 15—20 bp. Other in vitro recombination methods may involve the same homologous ends, including the In-Fusion Zhu et al. These methods are mostly sequence-independent, and because of this sequence flexibility, there is currently no standard protocol for designing the overlapping sequences.
Additionally, Gibson assembly requires a destination vector that is linearized by enzyme digestion or PCR, making it a method that is not totally free of restriction enzymes. Golden Gate cloning relies on the type IIs restriction enzymes, and is capable of assembling numerous fragments with high efficiency and fidelity Engler et al.
Type IIs restriction sites are often shorter than 7 bp and are frequently present within DNA sequences to be cloned, thereby limiting the application of Golden Gate cloning, especially for the cloning of long DNA fragments and multiple DNA fragments. In this study, we have developed a novel method for standardized molecular cloning known as Nimble Cloning.
This method, which is based on the Gibson assembly technique Gibson et al. We demonstrate that this cloning method is simple and efficient, and has great potential as a versatile tool for assembling DNA constructs. Agrobacterium tumefaciens strain GV was used for transforming plants. The E. Primers were ordered from ThermoFisher Guangzhou, China. The destination and entry vectors of the Nimble Cloning system were generated by inserting their cloning cassettes into the desired vector via Gibson assembly.
The two expression cassettes, including the promoter and the terminator, were then amplified and cloned into pGreen Hellens et al. The maps of the destination vectors were listed in Supplementary Figure S1. Wild-type Nicotiana benthamiana was used to analyze transient expression following an agroinfiltration step that was completed according to a slightly modified version of a published procedure Sparkes et al.
Plasmids were inserted into A. The Nimble Cloning system includes recipient expression destination vectors and entry vectors. During a Nimble Cloning reaction, the entry clone should carry a different resistance gene from that in the destination vector. A DNA fragment can be inserted into the entry vector to form the entry clone via TA cloning, or by Gibson cloning with adapters as overlapping sequences, after the entry vector has been digested with XcmI.
The DNA fragment in the entry clone or the PCR product flanked by the adapters can be cloned into the circular destination vector with the Nimble Mix during the Nimble Cloning reaction and the transformation of E coli. Figure 1. Nimble Cloning system. A Schematic of the destination and entry vectors in the Nimble Cloning system. B Schematic of the Nimble Cloning method.
The PCR product flanked by the adapters or the DNA fragment in the entry clone can be cloned into the circular destination vector in a one-step Nimble Cloning reaction. The DNA fragment can be inserted into the entry vector to form the entry clone via TA cloning, or by Gibson cloning using the adapters as overlapping sequences, after the entry vector is digested with XcmI.
Nimble Cloning involves Sfi I and T5 exonuclease. The two unique bp nucleotide sequences that form the NC frame adapters required for recombination were designed based on the criteria to increase the likelihood of accurate assembly and minimize the possibility that the expression levels of the nearby genes are affected Torella et al.
Thus, we computationally designed adapters 1 and 2 comprising the cagtggtctctgtccagtcct and cggtctcagcagaccacaagt sequences, respectively, and used them for the tests of cloning efficiency and gene expression. These two adapters enable efficient assembly and are appropriate for gene expression, as confirmed in the subsequent subsections. Nimble Cloning is based on Gibson assembly, and both methods involve the enzyme-catalyzed assembly of overlapping DNA fragments.
We assessed the enzyme requirements for Nimble Cloning reactions involving one or multiple DNA fragments. For multiple-fragment cloning, the junctions of the internal fragment do not use the unique adapters, but fragment-specific sequences Supplementary Table S1. Moreover, the cloning efficiency was higher than that of Gibson assembly, which involves the linearized pNC-UC vector and three enzymes.
Twelve colonies resulting from the Nimble Cloning of single and multiple DNA fragments were further analyzed by sequencing, and no errors were detected. Figure 2. Optimization of Nimble Cloning. Effects of enzymes and buffer components A,B , reaction temperatures C,D , and reaction times E,F on the efficiency and fidelity. The pNC-UC vector was used as the destination vector in each reaction.
Data are presented as the average and standard deviation of three parallel experiments. The data indicated that the efficiency and fidelity of the cloning of a single fragment were high even for the shortest time point 5 min , and the efficiency plateaued after 30 min. Regarding the cloning of three fragments, the efficiency and fidelity increased over time and plateaued after 60 min.
Molecular cloning is a basic technique in molecular biology and biotechnology laboratories. It is a useful tool to study a gene, modify the gene, reintroduce the modified gene into the natural host or another host, or to produce protein. Things to consider before you clone are the availability of your cloning materials, the goal of your research such as to sequence a DNA fragment or to produce a protein , and the difficulty level to perform your protocol.
The DNA insert must contain particular sequences at the end of the fragments compatible with the prepared vector. After a DNA fragment is incorporated into the plasmid vector, the next cloning step is to perform a transformation step.
In this transformation step, the recombinant DNA is introduced into the competent cell by chemical reaction or electroporation. Competent cells are cells which are temporarily permeable to extracellular DNA. The host organisms which are commonly used in the laboratories are Escherichia coli and Saccharomyces cerevisiae. Selective medium is a growth medium containing a selective agent to grow the transformed host. When you choose antibiotic selection for cloning, your growth medium must contain antibiotics.
The most common antibiotics used for selection are Ampicillin, Kanamycin, and Chloramphenicol. There are several different approaches to clone and you will need to find the right approach for your research. Below are some examples of popular cloning methods to generate a recombinant DNA construct:. Restriction enzymes are enzymes which cut DNA near at a specific short nucleotide sequence called a restriction site. This method is useful when have one DNA insert to incorporate into the plasmid.
Your DNA insert must not contain an internal restriction site similar to the restriction site on your plasmid. Your restriction enzyme can cut your DNA insert at this internal restriction site and produce unwanted smaller pieces of DNA fragments. You can choose to use one restriction enzyme or two enzymes to cut your DNA fragment and vector. When using two enzymes, both enzymes must be compatible or work well in the same restriction enzyme buffer. Restriction Enzyme Based Cloning.
Both the vector and DNA fragment are digested with restriction enzymes to create cohesive ends. The vector and DNA fragment are ligated. The recombinant DNA enters the host cell during transformation.
You can choose this method when your restriction enzymes are not compatible or you find an internal restriction enzyme site in your DNA insert. PCR Cloning. During ligation, PCR product is inserted into the vector.
Ligation independent cloning LIC is performed by generating short sequences at the end of a DNA insert that match to the short sequences of a plasmid vector.
The two materials are then combined for annealing step. During transformation, the host organism repairs the nicks on the recombinant DNA. Abstract Molecular cloning is based on isolation of a DNA sequence of interest to obtain multiple copies of it in vitro. Publication types Review. Molecular cloning can also be employed to take a series of genes, or gene cluster from one bacterial strain, reorganize them into plasmids that are transformed in another strain, so an entire biosynthetic pathway can be recreated to produce a complex molecule.
Through molecular cloning, a mutant library can be generated by expressing a target plasmid in a special bacterial strain that uses an error prone polymerase when cultured at certain temperatures. The mutations can be characterized by sequencing. Bacteria transformed with mutant genes can then be tested with different drug or chemicals to see which bacterial colonies have evolved to have drug resistance. Thanks to molecular cloning, reporter genes can be incorporated into DNA plasmids, a common reporter gene is green fluorescent protein or GFP, which emits a green fluorescence when exposed to UV light.
A reporter gene can also be inserted into an alphavirus to show infection in mosquitoes and transmissibility in cells. You should now understand how molecular cloning works and how the technique can be used in molecular biology. As always, thanks for watching! Subscription Required. Please recommend JoVE to your librarian. Basic Methods in Cellular and Molecular Biology. Molecular Cloning. To learn more about our GDPR policies click here. If you want more info regarding data storage, please contact gdpr jove.
Your access has now expired. Provide feedback to your librarian. If you have any questions, please do not hesitate to reach out to our customer success team. Login processing This is a sample clip. Sign in or start your free trial. Previous Video. Overview Procedure. Overview Molecular cloning is a set of methods, which are used to insert recombinant DNA into a vector - a carrier of DNA molecules that will replicate recombinant DNA fragments in host organisms.
Log in or Start trial to access full content. DNA Gel Electrophoresis. DNA Ligation Reactions.
0コメント